Spaces:
Sleeping
Sleeping
import gradio as gr | |
from transformers import AutoModelForSequenceClassification, AutoTokenizer | |
import torch.nn.functional as F | |
placeholder = 'GCTTTGGTTTATACCTTACACAACATAAATCACATAGTTAATCCCTAATCGTCTTTGATTCTCAATGTTTTGTTCATTTTTACCATGAACATCATCTGATTGATAAGTGCATAGAGAATTAACGGCTTACACTTTACACTTGCATAGATGATTCCTAAGTATGTCCT' | |
model_names = ['plant-dnabert', 'plant-dnagpt', 'plant-nucleotide-transformer', 'plant-dnagemma', | |
'dnabert2', 'nucleotide-transformer-v2-100m', 'agront-1b'] | |
tokenizer_type = "BPE" | |
model_names = [x + '-' + tokenizer_type if x.startswith("plant") else x for x in model_names] | |
task_map = { | |
"promoter": ["Not promoter", "Core promoter"], | |
"conservation": ["Not conserved", "Conserved"], | |
"H3K27ac": ["Not H3K27ac", "H3K27ac"], | |
"H3K27me3": ["Not H3K27me3", "H3K27me3"], | |
"H3K4me3": ["Not H3K4me3", "H3K4me3"], | |
"lncRNAs": ["Not lncRNA", "lncRNA"], | |
"open_chromatin": ['Not open chromatin', 'Full open chromatin', 'Partial open chromatin'], | |
} | |
task_lists = task_map.keys() | |
def inference(seq,model,task): | |
if not seq: | |
gr.Warning("No sequence provided, use the default sequence.") | |
seq = placeholder | |
# Load model and tokenizer | |
model_name = f'zhangtaolab/{model}-{task}' | |
model = AutoModelForSequenceClassification.from_pretrained(model_name,ignore_mismatched_sizes=True) | |
tokenizer = AutoTokenizer.from_pretrained(model_name) | |
# Inference | |
inputs = tokenizer(seq, return_tensors='pt', padding=True, truncation=True, max_length=512) | |
outputs = model(**inputs) | |
probabilities = F.softmax(outputs.logits,dim=-1).tolist()[0] | |
#Map probabilities to labels | |
labels = task_map[task] | |
result = {labels[i]: probabilities[i] for i in range(len(labels))} | |
return result | |
# Create Gradio interface | |
with gr.Blocks() as demo: | |
gr.HTML( | |
""" | |
<h1 style="text-align: center;">Prediction of H3K27ac histone modification in plant with LLMs</h1> | |
""" | |
) | |
with gr.Row(): | |
drop1 = gr.Dropdown(choices=task_lists, | |
label="Selected Task", | |
interactive=False, | |
value='H3K27ac') | |
drop2 = gr.Dropdown(choices=model_names, | |
label="Select Model", | |
interactive=True, | |
value=model_names[0]) | |
seq_input = gr.Textbox(label="Input Sequence", lines=6, placeholder=placeholder) | |
with gr.Row(): | |
predict_btn = gr.Button("Predict",variant="primary") | |
clear_btn = gr.Button("Clear") | |
output = gr.Label(label="Predict result") | |
predict_btn.click(inference, inputs=[seq_input,drop2, drop1], outputs=output) | |
clear_btn.click(lambda: ("", None), inputs=[], outputs=[seq_input, output]) | |
# Launch Gradio app | |
demo.launch() |